AusARG Exon Capture Raw 102.100.100/350810 AHHVV2AFX2 TTCTCCTATC

Paradelma orientalis, PMO 230 Australia Queensland

Data and Resources

Additional Info

Field Value
Geospatial Coverage

Dataset extent

Map tiles & Data by OpenStreetMap, under CC BY SA.
Resource Permissions organization_member
Sequence Data Type illumina-exoncapture
access_rights No restrictions
ala_species_name
ala_specimen_url
analysis_software
analysis_software_version
ancillary_notes NA
archive_ingestion_date 2021-05-10
associated_media NA
barcode_id
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1066/
birth_date
cell_postion
certainty NA
class Reptilia
collection_date 2018-11-29
collection_method Active on road
collector P.M. Oliver | R.J. Laver | S.V. Nielsen
collector_sample_id NA
common_name Brigalow Scaly-foot
contextual_data_submission_date
coord_uncertainty_metres unknown
country Australia
data_context Australian Amphibian and Reptile Genomics (AusARG)
data_custodian Ian Brennan
data_generated 2021-05-10
data_type Illumina Capture
dataset_id 102.100.100/351767
dataset_url
date_of_transfer 2021-05-04
death_date
decimal_latitude_public -26.90706
decimal_longitude_public 149.26062
description Short reads
dna_treatment Fragmentation by Covaris
experimental_design
facility brf
facility_project_code
facility_sample_id 349800_AHHVV2AFX2_TTCTCCTATC
family Pygopodidae
file_type
flowcell_id AHHVV2AFX2
flowcell_type Mid output 300 cycles
folder_name 20210504_AusARG_BRF_AHHVV2AFX2
genotypic_sex not determined
genus Paradelma
habitat Brigalow Belt
identified_by Paul Oliver
insert_size_range 150 bp PE
institution_name Queensland Museum
latitude -26.90706
library_comments 1/2 library reaction; qubit 9.94 ng/uL
library_construction_protocol NEXTFLEX Rapid DNA-Seq Kit 2.0
library_id 102.100.100/350810
library_index_seq_p5 CGTACATGCA
library_index_sequence
library_layout paired end
library_location ANU EBL
library_ng_ul 9.94
library_oligo_sequence
library_oligo_sequence_p5 AATGATACGGCGACCACCGAGATCTACAC cgtacatgcaACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_pcr_cycles 6.0
library_pcr_reps 1.0
library_prep_date 2021-02-19
library_prepared_by Ian Brennan
library_selection Hybrid Selection
library_source GENOMIC
library_strategy Targeted-Capture
library_type exon capture
lifestage adult
location_generalisation
location_text Yuleba-Surat Rd.
longitude 149.26062
material_conc_ng_ul 100.0
material_extracted_by Ian Brennan
material_extraction_date 2020-09-01
material_extraction_method Salt extraction
material_extraction_type DNA
method_of_determination NA
movie_length
n_libraries_pooled 32
order Squamata
p5_library_index_id
p5_library_index_sequence
p5_library_oligo_sequence
p7_library_index_id UDI_0022
p7_library_index_sequence TTCTCCTATC
p7_library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCAC ttctcctatcATCTCGTATGCCGTCTTCTGCTTG
phenotypic_sex not determined
phylum Chordata
prior_genetics NA
sample_custodian Paul Oliver
sample_id 102.100.100/349800
sample_quality unknown
sample_submission_date 2021-05-04
sequencing_facility BRF
sequencing_kit_chemistry_version NextSeq 500 midoutput 300 cycles V2.5
sequencing_model NextSeq 500
sequencing_platform ILLUMINA
source_population NA
species orientalis
species_name Paradelma orientalis
specimen_id PMO 230
specimen_id_description Paul M. Oliver Tissue Collection
state_or_region Queensland
subspecies NA
taxon_id 592670.0
taxonomic_group lizard | gecko
ticket BPAOPS-1066
tissue_collection Herpetology (R)
tissue_number PMO 230
tissue_preservation ethanol
tissue_type tail
type_status non type
voucher_id
voucher_or_tissue_number PMO 230
wild_captive wild
work_order 13018.0