AusARG Exon Capture Raw 102.100.100/350809 AHHVV2AFX2 GATGAGCGAA

Ophidiocephalus taeniatus, SAMA R28366 Australia South Australia

Data and Resources

Additional Info

Field Value
Geospatial Coverage

Dataset extent

Map tiles & Data by OpenStreetMap, under CC BY SA.
Resource Permissions organization_member
Sequence Data Type illumina-exoncapture
access_rights No restrictions
ala_species_name
ala_specimen_url https://ozcam.ala.org.au/occurrences/6c8268de-76aa-468d-b094-e4eaca29d55c
analysis_software
analysis_software_version
ancillary_notes NA
archive_ingestion_date 2021-05-10
associated_media NA
barcode_id
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1066/
birth_date
cell_postion
certainty NA
class Reptilia
collection_date 1985-08-22
collection_method unknown
collector T. Schwaner | B. Miller | S. Sarre
collector_sample_id NA
common_name Bronzeback
contextual_data_submission_date
coord_uncertainty_metres unknown
country Australia
data_context Australian Amphibian and Reptile Genomics (AusARG)
data_custodian Ian Brennan
data_generated 2021-05-10
data_type Illumina Capture
dataset_id 102.100.100/351767
dataset_url
date_of_transfer 2021-05-04
death_date
decimal_latitude_public -26.12
decimal_longitude_public 134.85
description Short reads
dna_treatment Fragmentation by Covaris
experimental_design
facility brf
facility_project_code
facility_sample_id 349799_AHHVV2AFX2_GATGAGCGAA
family Pygopodidae
file_type
flowcell_id AHHVV2AFX2
flowcell_type Mid output 300 cycles
folder_name 20210504_AusARG_BRF_AHHVV2AFX2
genotypic_sex not determined
genus Ophidiocephalus
habitat unknown
identified_by Unknown
insert_size_range 150 bp PE
institution_name South Australia Museum
latitude -26.12
library_comments 1/2 library reaction; qubit 19.5 ng/uL
library_construction_protocol NEXTFLEX Rapid DNA-Seq Kit 2.0
library_id 102.100.100/350809
library_index_seq_p5 AACGCGGATT
library_index_sequence
library_layout paired end
library_location ANU EBL
library_ng_ul 19.5
library_oligo_sequence
library_oligo_sequence_p5 AATGATACGGCGACCACCGAGATCTACAC aacgcggattACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_pcr_cycles 6.0
library_pcr_reps 1.0
library_prep_date 2021-02-19
library_prepared_by Ian Brennan
library_selection Hybrid Selection
library_source GENOMIC
library_strategy Targeted-Capture
library_type exon capture
lifestage unknown
location_generalisation
location_text Abminga R/S
longitude 134.85
material_conc_ng_ul 116.0
material_extracted_by Ian Brennan
material_extraction_date 2020-09-01
material_extraction_method Salt extraction
material_extraction_type DNA
method_of_determination NA
movie_length
n_libraries_pooled 32
order Squamata
p5_library_index_id
p5_library_index_sequence
p5_library_oligo_sequence
p7_library_index_id UDI_0021
p7_library_index_sequence GATGAGCGAA
p7_library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCAC gatgagcgaaATCTCGTATGCCGTCTTCTGCTTG
phenotypic_sex not determined
phylum Chordata
prior_genetics NA
sample_custodian Stephen Donnellan
sample_id 102.100.100/349799
sample_quality unknown
sample_submission_date 2021-05-04
sequencing_facility BRF
sequencing_kit_chemistry_version NextSeq 500 midoutput 300 cycles V2.5
sequencing_model NextSeq 500
sequencing_platform ILLUMINA
source_population NA
species taeniatus
species_name Ophidiocephalus taeniatus
specimen_id SAMA R28366
specimen_id_description South Australia Museum
state_or_region South Australia
subspecies NA
taxon_id 207563.0
taxonomic_group lizard | gecko
ticket BPAOPS-1066
tissue_collection Herpetology (R)
tissue_number SAMA R28366
tissue_preservation -80C | ethanol
tissue_type liver
type_status non type
voucher_id
voucher_or_tissue_number SAMA R28366
wild_captive wild
work_order 13018.0