AusARG Exon Capture Raw 102.100.100/350806 AHHVV2AFX2 CACATACGGA

Pletholax gracilis, WAM R154023 Australia Western Australia

Data and Resources

Additional Info

Field Value
Geospatial Coverage

Dataset extent

Map tiles & Data by OpenStreetMap, under CC BY SA.
Resource Permissions organization_member
Sequence Data Type illumina-exoncapture
access_rights No restrictions
ala_species_name
ala_specimen_url https://ozcam.ala.org.au/occurrences/e68dbc9a-ba74-474f-bb92-ec4fbf3af2e7
analysis_software
analysis_software_version
ancillary_notes NA
archive_ingestion_date 2021-05-10
associated_media NA
barcode_id
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1066/
birth_date
cell_postion
certainty high
class Reptilia
collection_date 2003-11-04
collection_method Pit Trap
collector Paul Doughty | Brad Maryan
collector_sample_id NA
common_name Keeled Legless lizard
contextual_data_submission_date
coord_uncertainty_metres unknown
country Australia
data_context Australian Amphibian and Reptile Genomics (AusARG)
data_custodian Ian Brennan
data_generated 2021-05-10
data_type Illumina Capture
dataset_id 102.100.100/351767
dataset_url
date_of_transfer 2021-05-04
death_date
decimal_latitude_public -31.654722
decimal_longitude_public 115.923889
description Short reads
dna_treatment Fragmentation by Covaris
experimental_design
facility brf
facility_project_code
facility_sample_id 349796_AHHVV2AFX2_CACATACGGA
family Pygopodidae
file_type
flowcell_id AHHVV2AFX2
flowcell_type Mid output 300 cycles
folder_name 20210504_AusARG_BRF_AHHVV2AFX2
genotypic_sex not determined
genus Pletholax
habitat unknown
identified_by Brad Maryan
insert_size_range 150 bp PE
institution_name Western Australian Museum
latitude -31.654722
library_comments 1/2 library reaction; qubit 14 ng/uL
library_construction_protocol NEXTFLEX Rapid DNA-Seq Kit 2.0
library_id 102.100.100/350806
library_index_seq_p5 GTGATTGAAC
library_index_sequence
library_layout paired end
library_location ANU EBL
library_ng_ul 14.0
library_oligo_sequence
library_oligo_sequence_p5 AATGATACGGCGACCACCGAGATCTACAC gtgattgaacACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_pcr_cycles 6.0
library_pcr_reps 1.0
library_prep_date 2021-02-19
library_prepared_by Ian Brennan
library_selection Hybrid Selection
library_source GENOMIC
library_strategy Targeted-Capture
library_type exon capture
lifestage adult
location_generalisation
location_text Muchea Air Weapons Range
longitude 115.923889
material_conc_ng_ul 116.0
material_extracted_by Ian Brennan
material_extraction_date 2020-09-01
material_extraction_method Salt extraction
material_extraction_type DNA
method_of_determination hemipenis eversion
movie_length
n_libraries_pooled 32
order Squamata
p5_library_index_id
p5_library_index_sequence
p5_library_oligo_sequence
p7_library_index_id UDI_0018
p7_library_index_sequence CACATACGGA
p7_library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCAC cacatacggaATCTCGTATGCCGTCTTCTGCTTG
phenotypic_sex male
phylum Chordata
prior_genetics NA
sample_custodian Paul Doughty
sample_id 102.100.100/349796
sample_quality unknown
sample_submission_date 2021-05-04
sequencing_facility BRF
sequencing_kit_chemistry_version NextSeq 500 midoutput 300 cycles V2.5
sequencing_model NextSeq 500
sequencing_platform ILLUMINA
source_population NA
species gracilis
species_name Pletholax gracilis
specimen_id WAM R154023
specimen_id_description Western Australian Museum
state_or_region Western Australia
subspecies NA
taxon_id 207565.0
taxonomic_group lizard | gecko
ticket BPAOPS-1066
tissue_collection Herpetology (R)
tissue_number WAM R154023
tissue_preservation -80C | ethanol
tissue_type liver
type_status non type
voucher_id
voucher_or_tissue_number WAM R154023
wild_captive wild
work_order 13018.0