AusARG Exon Capture Raw 102.100.100/350803 AHHVV2AFX2 TCGGTGGAAC

Lialis burtonis, RJE 1104-07 Australia Western Australia

Data and Resources

Additional Info

Field Value
Geospatial Coverage

Dataset extent

Map tiles & Data by OpenStreetMap, under CC BY SA.
Resource Permissions organization_member
Sequence Data Type illumina-exoncapture
access_rights No restrictions
ala_species_name
ala_specimen_url
analysis_software
analysis_software_version
ancillary_notes NA
archive_ingestion_date 2021-05-10
associated_media NA
barcode_id
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1066/
birth_date
cell_postion
certainty NA
class Reptilia
collection_date 2015-08-11
collection_method Pit Trap
collector R.J. Ellis
collector_sample_id NA
common_name Burton's Legless lizard
contextual_data_submission_date
coord_uncertainty_metres unknown
country Australia
data_context Australian Amphibian and Reptile Genomics (AusARG)
data_custodian Ian Brennan
data_generated 2021-05-10
data_type Illumina Capture
dataset_id 102.100.100/351767
dataset_url
date_of_transfer 2021-05-04
death_date
decimal_latitude_public -31.600508
decimal_longitude_public 115.764576
description Short reads
dna_treatment Fragmentation by Covaris
experimental_design
facility brf
facility_project_code
facility_sample_id 349793_AHHVV2AFX2_TCGGTGGAAC
family Pygopodidae
file_type
flowcell_id AHHVV2AFX2
flowcell_type Mid output 300 cycles
folder_name 20210504_AusARG_BRF_AHHVV2AFX2
genotypic_sex not determined
genus Lialis
habitat dense patchy shrubland on low hill with sandy substrate and exposed limestone rock
identified_by Ryan Ellis
insert_size_range 150 bp PE
institution_name Western Australian Museum
latitude -31.600508
library_comments 1/2 library reaction; qubit 41 ng/uL
library_construction_protocol NEXTFLEX Rapid DNA-Seq Kit 2.0
library_id 102.100.100/350803
library_index_seq_p5 GTGCAGTATA
library_index_sequence
library_layout paired end
library_location ANU EBL
library_ng_ul 41.0
library_oligo_sequence
library_oligo_sequence_p5 AATGATACGGCGACCACCGAGATCTACAC gtgcagtataACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_pcr_cycles 6.0
library_pcr_reps 1.0
library_prep_date 2021-02-19
library_prepared_by Liz Broady
library_selection Hybrid Selection
library_source GENOMIC
library_strategy Targeted-Capture
library_type exon capture
lifestage adult
location_generalisation
location_text Pinjar
longitude 115.764576
material_conc_ng_ul 77.8
material_extracted_by Ian Brennan
material_extraction_date 2020-09-01
material_extraction_method Salt extraction
material_extraction_type DNA
method_of_determination NA
movie_length
n_libraries_pooled 32
order Squamata
p5_library_index_id
p5_library_index_sequence
p5_library_oligo_sequence
p7_library_index_id UDI_0015
p7_library_index_sequence TCGGTGGAAC
p7_library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCAC tcggtggaacATCTCGTATGCCGTCTTCTGCTTG
phenotypic_sex not determined
phylum Chordata
prior_genetics NA
sample_custodian Paul Doughty
sample_id 102.100.100/349793
sample_quality unknown
sample_submission_date 2021-05-04
sequencing_facility BRF
sequencing_kit_chemistry_version NextSeq 500 midoutput 300 cycles V2.5
sequencing_model NextSeq 500
sequencing_platform ILLUMINA
source_population NA
species burtonis
species_name Lialis burtonis
specimen_id RJE 1104-07
specimen_id_description Ryan J. Ellis Tissue Collection
state_or_region Western Australia
subspecies NA
taxon_id 95110.0
taxonomic_group lizard | gecko
ticket BPAOPS-1066
tissue_collection Herpetology (R)
tissue_number RJE 1104-07
tissue_preservation ethanol
tissue_type liver
type_status non type
voucher_id
voucher_or_tissue_number RJE 1104-07
wild_captive wild
work_order 13018.0